ID: 993296181

View in Genome Browser
Species Human (GRCh38)
Location 5:86144125-86144147
Sequence CATCTGGCTGGAGCCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993296174_993296181 13 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG No data
993296175_993296181 12 Left 993296175 5:86144090-86144112 CCGGGAGAGGCTGTTGATACATG No data
Right 993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993296181 Original CRISPR CATCTGGCTGGAGCCCAGGC AGG Intergenic
No off target data available for this crispr