ID: 993302778

View in Genome Browser
Species Human (GRCh38)
Location 5:86232679-86232701
Sequence GTGTTTTAAGAATAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993302778_993302781 1 Left 993302778 5:86232679-86232701 CCCCAAGGCTATTCTTAAAACAC No data
Right 993302781 5:86232703-86232725 TAAAACATGCATTTTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993302778 Original CRISPR GTGTTTTAAGAATAGCCTTG GGG (reversed) Intergenic
No off target data available for this crispr