ID: 993306699

View in Genome Browser
Species Human (GRCh38)
Location 5:86283469-86283491
Sequence CGGGACACTCCCTGCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993306699_993306708 10 Left 993306699 5:86283469-86283491 CCTTCAAAGCAGGGAGTGTCCCG No data
Right 993306708 5:86283502-86283524 AGTGCTGCTTCCTGGGGCACAGG No data
993306699_993306705 2 Left 993306699 5:86283469-86283491 CCTTCAAAGCAGGGAGTGTCCCG No data
Right 993306705 5:86283494-86283516 GAGAGGGAAGTGCTGCTTCCTGG No data
993306699_993306706 3 Left 993306699 5:86283469-86283491 CCTTCAAAGCAGGGAGTGTCCCG No data
Right 993306706 5:86283495-86283517 AGAGGGAAGTGCTGCTTCCTGGG No data
993306699_993306707 4 Left 993306699 5:86283469-86283491 CCTTCAAAGCAGGGAGTGTCCCG No data
Right 993306707 5:86283496-86283518 GAGGGAAGTGCTGCTTCCTGGGG No data
993306699_993306710 28 Left 993306699 5:86283469-86283491 CCTTCAAAGCAGGGAGTGTCCCG No data
Right 993306710 5:86283520-86283542 ACAGGCTCTTATTCCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993306699 Original CRISPR CGGGACACTCCCTGCTTTGA AGG (reversed) Intergenic
No off target data available for this crispr