ID: 993308975

View in Genome Browser
Species Human (GRCh38)
Location 5:86304379-86304401
Sequence TTCCAAACTGCCTGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308975_993308983 8 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308983 5:86304410-86304432 AGGGAGGATTCCTTGAACCCAGG 0: 4
1: 97
2: 2555
3: 22021
4: 107846
993308975_993308980 -8 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308980 5:86304394-86304416 GTTTGGAAACCCAAGGAGGGAGG No data
993308975_993308986 25 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data
993308975_993308988 26 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417
993308975_993308989 27 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308975 Original CRISPR TTCCAAACTGCCTGGATTAC AGG (reversed) Intergenic
No off target data available for this crispr