ID: 993308981

View in Genome Browser
Species Human (GRCh38)
Location 5:86304403-86304425
Sequence TCAAGGAATCCTCCCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308981_993308986 1 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data
993308981_993308989 3 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data
993308981_993308988 2 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308981 Original CRISPR TCAAGGAATCCTCCCTCCTT GGG (reversed) Intergenic
No off target data available for this crispr