ID: 993308983

View in Genome Browser
Species Human (GRCh38)
Location 5:86304410-86304432
Sequence AGGGAGGATTCCTTGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132523
Summary {0: 4, 1: 97, 2: 2555, 3: 22021, 4: 107846}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308975_993308983 8 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308983 5:86304410-86304432 AGGGAGGATTCCTTGAACCCAGG 0: 4
1: 97
2: 2555
3: 22021
4: 107846
993308972_993308983 27 Left 993308972 5:86304360-86304382 CCAGGCATGGTGGCTCATGCCTG 0: 8252
1: 39501
2: 100261
3: 172981
4: 199558
Right 993308983 5:86304410-86304432 AGGGAGGATTCCTTGAACCCAGG 0: 4
1: 97
2: 2555
3: 22021
4: 107846
993308976_993308983 0 Left 993308976 5:86304387-86304409 CCAGGCAGTTTGGAAACCCAAGG No data
Right 993308983 5:86304410-86304432 AGGGAGGATTCCTTGAACCCAGG 0: 4
1: 97
2: 2555
3: 22021
4: 107846

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308983 Original CRISPR AGGGAGGATTCCTTGAACCC AGG Intergenic
Too many off-targets to display for this crispr