ID: 993308986

View in Genome Browser
Species Human (GRCh38)
Location 5:86304427-86304449
Sequence CCCAGGAGTTTGAGATCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308976_993308986 17 Left 993308976 5:86304387-86304409 CCAGGCAGTTTGGAAACCCAAGG No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data
993308981_993308986 1 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data
993308975_993308986 25 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data
993308982_993308986 0 Left 993308982 5:86304404-86304426 CCAAGGAGGGAGGATTCCTTGAA No data
Right 993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308986 Original CRISPR CCCAGGAGTTTGAGATCAGA CGG Intergenic
No off target data available for this crispr