ID: 993308988

View in Genome Browser
Species Human (GRCh38)
Location 5:86304428-86304450
Sequence CCAGGAGTTTGAGATCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293811
Summary {0: 30, 1: 2118, 2: 28031, 3: 98215, 4: 165417}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308976_993308988 18 Left 993308976 5:86304387-86304409 CCAGGCAGTTTGGAAACCCAAGG No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417
993308982_993308988 1 Left 993308982 5:86304404-86304426 CCAAGGAGGGAGGATTCCTTGAA No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417
993308975_993308988 26 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417
993308981_993308988 2 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308988 5:86304428-86304450 CCAGGAGTTTGAGATCAGACGGG 0: 30
1: 2118
2: 28031
3: 98215
4: 165417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308988 Original CRISPR CCAGGAGTTTGAGATCAGAC GGG Intergenic
Too many off-targets to display for this crispr