ID: 993308989

View in Genome Browser
Species Human (GRCh38)
Location 5:86304429-86304451
Sequence CAGGAGTTTGAGATCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993308982_993308989 2 Left 993308982 5:86304404-86304426 CCAAGGAGGGAGGATTCCTTGAA No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data
993308976_993308989 19 Left 993308976 5:86304387-86304409 CCAGGCAGTTTGGAAACCCAAGG No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data
993308981_993308989 3 Left 993308981 5:86304403-86304425 CCCAAGGAGGGAGGATTCCTTGA No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data
993308975_993308989 27 Left 993308975 5:86304379-86304401 CCTGTAATCCAGGCAGTTTGGAA No data
Right 993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993308989 Original CRISPR CAGGAGTTTGAGATCAGACG GGG Intergenic
No off target data available for this crispr