ID: 993314135

View in Genome Browser
Species Human (GRCh38)
Location 5:86377434-86377456
Sequence GACATAGAAGATGCTAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993314135_993314138 -1 Left 993314135 5:86377434-86377456 CCACAACTAGCATCTTCTATGTC No data
Right 993314138 5:86377456-86377478 CTATATAATTAGGTGGAACTAGG No data
993314135_993314137 -8 Left 993314135 5:86377434-86377456 CCACAACTAGCATCTTCTATGTC No data
Right 993314137 5:86377449-86377471 TCTATGTCTATATAATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993314135 Original CRISPR GACATAGAAGATGCTAGTTG TGG (reversed) Intergenic
No off target data available for this crispr