ID: 993314138

View in Genome Browser
Species Human (GRCh38)
Location 5:86377456-86377478
Sequence CTATATAATTAGGTGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993314135_993314138 -1 Left 993314135 5:86377434-86377456 CCACAACTAGCATCTTCTATGTC No data
Right 993314138 5:86377456-86377478 CTATATAATTAGGTGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993314138 Original CRISPR CTATATAATTAGGTGGAACT AGG Intergenic
No off target data available for this crispr