ID: 993314671

View in Genome Browser
Species Human (GRCh38)
Location 5:86386811-86386833
Sequence TGACATTGAAACATTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993314671_993314674 0 Left 993314671 5:86386811-86386833 CCGTGCCCAATGTTTCAATGTCA No data
Right 993314674 5:86386834-86386856 TAATAAACTAAGTTATTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993314671 Original CRISPR TGACATTGAAACATTGGGCA CGG (reversed) Intergenic
No off target data available for this crispr