ID: 993315091

View in Genome Browser
Species Human (GRCh38)
Location 5:86393791-86393813
Sequence TGGAAATGTAGCCATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993315091_993315093 29 Left 993315091 5:86393791-86393813 CCAACACAATGGCTACATTTCCA No data
Right 993315093 5:86393843-86393865 TGAACCACTTATACTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993315091 Original CRISPR TGGAAATGTAGCCATTGTGT TGG (reversed) Intergenic
No off target data available for this crispr