ID: 993319825

View in Genome Browser
Species Human (GRCh38)
Location 5:86458549-86458571
Sequence AGTTATCTGCAGAAGATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993319825_993319827 15 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319827 5:86458587-86458609 GATAGCTCTTGGCTTGTTACCGG No data
993319825_993319826 4 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG No data
993319825_993319829 22 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319829 5:86458594-86458616 CTTGGCTTGTTACCGGGCTTTGG No data
993319825_993319828 16 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319828 5:86458588-86458610 ATAGCTCTTGGCTTGTTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993319825 Original CRISPR AGTTATCTGCAGAAGATAGT AGG (reversed) Intergenic
No off target data available for this crispr