ID: 993319826

View in Genome Browser
Species Human (GRCh38)
Location 5:86458576-86458598
Sequence TCTTTTTGAGAGATAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993319824_993319826 5 Left 993319824 5:86458548-86458570 CCCTACTATCTTCTGCAGATAAC No data
Right 993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG No data
993319825_993319826 4 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG No data
993319823_993319826 27 Left 993319823 5:86458526-86458548 CCTCTAGGATTTTGGAGCAAGGC 0: 143
1: 187
2: 148
3: 132
4: 240
Right 993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993319826 Original CRISPR TCTTTTTGAGAGATAGCTCT TGG Intergenic
No off target data available for this crispr