ID: 993319829

View in Genome Browser
Species Human (GRCh38)
Location 5:86458594-86458616
Sequence CTTGGCTTGTTACCGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993319825_993319829 22 Left 993319825 5:86458549-86458571 CCTACTATCTTCTGCAGATAACT No data
Right 993319829 5:86458594-86458616 CTTGGCTTGTTACCGGGCTTTGG No data
993319824_993319829 23 Left 993319824 5:86458548-86458570 CCCTACTATCTTCTGCAGATAAC No data
Right 993319829 5:86458594-86458616 CTTGGCTTGTTACCGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993319829 Original CRISPR CTTGGCTTGTTACCGGGCTT TGG Intergenic
No off target data available for this crispr