ID: 993321021

View in Genome Browser
Species Human (GRCh38)
Location 5:86467254-86467276
Sequence CCCCTGTGATTAAGGTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993321017_993321021 6 Left 993321017 5:86467225-86467247 CCAGCATGCTGTCACTTCTCATT No data
Right 993321021 5:86467254-86467276 CCCCTGTGATTAAGGTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993321021 Original CRISPR CCCCTGTGATTAAGGTCAAT GGG Intergenic
No off target data available for this crispr