ID: 993328586

View in Genome Browser
Species Human (GRCh38)
Location 5:86569775-86569797
Sequence CTGCTGGCCCTGGGCAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993328586_993328597 3 Left 993328586 5:86569775-86569797 CCCTCTTTGCCCAGGGCCAGCAG No data
Right 993328597 5:86569801-86569823 CGGCCGGCTGCTCCGAGTGCGGG 0: 148
1: 311
2: 522
3: 455
4: 500
993328586_993328598 4 Left 993328586 5:86569775-86569797 CCCTCTTTGCCCAGGGCCAGCAG No data
Right 993328598 5:86569802-86569824 GGCCGGCTGCTCCGAGTGCGGGG 0: 154
1: 380
2: 402
3: 383
4: 415
993328586_993328596 2 Left 993328586 5:86569775-86569797 CCCTCTTTGCCCAGGGCCAGCAG No data
Right 993328596 5:86569800-86569822 CCGGCCGGCTGCTCCGAGTGCGG 0: 130
1: 284
2: 464
3: 378
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993328586 Original CRISPR CTGCTGGCCCTGGGCAAAGA GGG (reversed) Intergenic
No off target data available for this crispr