ID: 993330646

View in Genome Browser
Species Human (GRCh38)
Location 5:86595960-86595982
Sequence ATCATTGCCTAGAAGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993330646_993330647 -8 Left 993330646 5:86595960-86595982 CCATAGTTCTTCTAGGCAATGAT No data
Right 993330647 5:86595975-86595997 GCAATGATAGTAAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993330646 Original CRISPR ATCATTGCCTAGAAGAACTA TGG (reversed) Intergenic
No off target data available for this crispr