ID: 993335449

View in Genome Browser
Species Human (GRCh38)
Location 5:86652615-86652637
Sequence ATGCATATAGTCATGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993335449_993335451 26 Left 993335449 5:86652615-86652637 CCTGGCTACATGACTATATGCAT No data
Right 993335451 5:86652664-86652686 AAAGGATGCTGTGAGTTCAGAGG No data
993335449_993335450 8 Left 993335449 5:86652615-86652637 CCTGGCTACATGACTATATGCAT No data
Right 993335450 5:86652646-86652668 AGTCAGAGCTAACACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993335449 Original CRISPR ATGCATATAGTCATGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr