ID: 993336922

View in Genome Browser
Species Human (GRCh38)
Location 5:86671185-86671207
Sequence CTTTATAAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993336920_993336922 -6 Left 993336920 5:86671168-86671190 CCCAGTCTCGGGTATGTCTTTAT 0: 1089
1: 6581
2: 9092
3: 10197
4: 9715
Right 993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG No data
993336916_993336922 14 Left 993336916 5:86671148-86671170 CCTCTTTCCTTTATAAATTACCC 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
Right 993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG No data
993336921_993336922 -7 Left 993336921 5:86671169-86671191 CCAGTCTCGGGTATGTCTTTATA 0: 36
1: 1587
2: 9198
3: 13069
4: 11945
Right 993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG No data
993336915_993336922 23 Left 993336915 5:86671139-86671161 CCAATTAAACCTCTTTCCTTTAT 0: 194
1: 2224
2: 4314
3: 4000
4: 3705
Right 993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG No data
993336917_993336922 7 Left 993336917 5:86671155-86671177 CCTTTATAAATTACCCAGTCTCG 0: 590
1: 4234
2: 4908
3: 3108
4: 1529
Right 993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993336922 Original CRISPR CTTTATAAGCAGCATGAGAA TGG Intergenic
No off target data available for this crispr