ID: 993341885

View in Genome Browser
Species Human (GRCh38)
Location 5:86734799-86734821
Sequence CAAAGCTATTACATTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993341885_993341888 4 Left 993341885 5:86734799-86734821 CCTCATTAAATGTAATAGCTTTG No data
Right 993341888 5:86734826-86734848 AGCAAAAGAAACTATCAACAGGG 0: 55
1: 167
2: 275
3: 274
4: 662
993341885_993341887 3 Left 993341885 5:86734799-86734821 CCTCATTAAATGTAATAGCTTTG No data
Right 993341887 5:86734825-86734847 CAGCAAAAGAAACTATCAACAGG 0: 52
1: 189
2: 257
3: 242
4: 433
993341885_993341889 28 Left 993341885 5:86734799-86734821 CCTCATTAAATGTAATAGCTTTG No data
Right 993341889 5:86734850-86734872 AAGCAGACATCCTACAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993341885 Original CRISPR CAAAGCTATTACATTTAATG AGG (reversed) Intergenic
No off target data available for this crispr