ID: 993346864

View in Genome Browser
Species Human (GRCh38)
Location 5:86794940-86794962
Sequence AACCATATTATGCTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993346864_993346868 23 Left 993346864 5:86794940-86794962 CCTGGGAGAAGCATAATATGGTT No data
Right 993346868 5:86794986-86795008 GGGGAAAATGATCTTATCCCAGG No data
993346864_993346866 3 Left 993346864 5:86794940-86794962 CCTGGGAGAAGCATAATATGGTT No data
Right 993346866 5:86794966-86794988 ATTTGTGCATTTATCTAAATGGG No data
993346864_993346865 2 Left 993346864 5:86794940-86794962 CCTGGGAGAAGCATAATATGGTT No data
Right 993346865 5:86794965-86794987 TATTTGTGCATTTATCTAAATGG No data
993346864_993346867 4 Left 993346864 5:86794940-86794962 CCTGGGAGAAGCATAATATGGTT No data
Right 993346867 5:86794967-86794989 TTTGTGCATTTATCTAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993346864 Original CRISPR AACCATATTATGCTTCTCCC AGG (reversed) Intergenic
No off target data available for this crispr