ID: 993346923

View in Genome Browser
Species Human (GRCh38)
Location 5:86795719-86795741
Sequence AAGGAGAAAACAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993346918_993346923 2 Left 993346918 5:86795694-86795716 CCATCTTGTCTGGGACCTAATTA No data
Right 993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993346923 Original CRISPR AAGGAGAAAACAAAGGAGGA AGG Intergenic
No off target data available for this crispr