ID: 993348586

View in Genome Browser
Species Human (GRCh38)
Location 5:86818258-86818280
Sequence TTTTAGGCTAACAACTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993348581_993348586 13 Left 993348581 5:86818222-86818244 CCACCTTGGTCCACTTAAATTGT No data
Right 993348586 5:86818258-86818280 TTTTAGGCTAACAACTGGAAAGG No data
993348583_993348586 3 Left 993348583 5:86818232-86818254 CCACTTAAATTGTATTTTGTGAA No data
Right 993348586 5:86818258-86818280 TTTTAGGCTAACAACTGGAAAGG No data
993348582_993348586 10 Left 993348582 5:86818225-86818247 CCTTGGTCCACTTAAATTGTATT No data
Right 993348586 5:86818258-86818280 TTTTAGGCTAACAACTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993348586 Original CRISPR TTTTAGGCTAACAACTGGAA AGG Intergenic
No off target data available for this crispr