ID: 993352095

View in Genome Browser
Species Human (GRCh38)
Location 5:86862646-86862668
Sequence TTCTGCCAACTTTTCTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993352087_993352095 16 Left 993352087 5:86862607-86862629 CCCCGGAGTCCTCCTTCTACCTT No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352084_993352095 21 Left 993352084 5:86862602-86862624 CCCCTCCCCGGAGTCCTCCTTCT No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352092_993352095 -3 Left 993352092 5:86862626-86862648 CCTTCATATTCCATTCTAACTTC No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352089_993352095 14 Left 993352089 5:86862609-86862631 CCGGAGTCCTCCTTCTACCTTCA No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352091_993352095 4 Left 993352091 5:86862619-86862641 CCTTCTACCTTCATATTCCATTC No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352085_993352095 20 Left 993352085 5:86862603-86862625 CCCTCCCCGGAGTCCTCCTTCTA No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352090_993352095 7 Left 993352090 5:86862616-86862638 CCTCCTTCTACCTTCATATTCCA No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352086_993352095 19 Left 993352086 5:86862604-86862626 CCTCCCCGGAGTCCTCCTTCTAC No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352088_993352095 15 Left 993352088 5:86862608-86862630 CCCGGAGTCCTCCTTCTACCTTC No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data
993352083_993352095 22 Left 993352083 5:86862601-86862623 CCCCCTCCCCGGAGTCCTCCTTC No data
Right 993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993352095 Original CRISPR TTCTGCCAACTTTTCTTTTT GGG Intergenic
No off target data available for this crispr