ID: 993356905

View in Genome Browser
Species Human (GRCh38)
Location 5:86924617-86924639
Sequence ATGACAATGTTAAGTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993356905_993356906 14 Left 993356905 5:86924617-86924639 CCAAACAAACTTAACATTGTCAT No data
Right 993356906 5:86924654-86924676 GTATGTGCTGTCTCCCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993356905 Original CRISPR ATGACAATGTTAAGTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr