ID: 993359390

View in Genome Browser
Species Human (GRCh38)
Location 5:86955345-86955367
Sequence TACACTTTTGCTGTGTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993359390_993359393 3 Left 993359390 5:86955345-86955367 CCATAAGACACAGCAAAAGTGTA No data
Right 993359393 5:86955371-86955393 AATACCTTTTCTGTGTTTGGAGG No data
993359390_993359391 0 Left 993359390 5:86955345-86955367 CCATAAGACACAGCAAAAGTGTA No data
Right 993359391 5:86955368-86955390 GCCAATACCTTTTCTGTGTTTGG No data
993359390_993359395 12 Left 993359390 5:86955345-86955367 CCATAAGACACAGCAAAAGTGTA No data
Right 993359395 5:86955380-86955402 TCTGTGTTTGGAGGAGAATGAGG No data
993359390_993359396 13 Left 993359390 5:86955345-86955367 CCATAAGACACAGCAAAAGTGTA No data
Right 993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993359390 Original CRISPR TACACTTTTGCTGTGTCTTA TGG (reversed) Intergenic
No off target data available for this crispr