ID: 993359396

View in Genome Browser
Species Human (GRCh38)
Location 5:86955381-86955403
Sequence CTGTGTTTGGAGGAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993359390_993359396 13 Left 993359390 5:86955345-86955367 CCATAAGACACAGCAAAAGTGTA No data
Right 993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993359396 Original CRISPR CTGTGTTTGGAGGAGAATGA GGG Intergenic
No off target data available for this crispr