ID: 993360903

View in Genome Browser
Species Human (GRCh38)
Location 5:86975130-86975152
Sequence CAGATGTGTGGAGGTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993360897_993360903 8 Left 993360897 5:86975099-86975121 CCTGGAAAAGGGTGATCATAATG No data
Right 993360903 5:86975130-86975152 CAGATGTGTGGAGGTTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993360903 Original CRISPR CAGATGTGTGGAGGTTGTAC TGG Intergenic
No off target data available for this crispr