ID: 993367467

View in Genome Browser
Species Human (GRCh38)
Location 5:87050947-87050969
Sequence CACAGCTATTGGTCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993367467_993367472 16 Left 993367467 5:87050947-87050969 CCAGTAACAGACCAATAGCTGTG No data
Right 993367472 5:87050986-87051008 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
993367467_993367471 15 Left 993367467 5:87050947-87050969 CCAGTAACAGACCAATAGCTGTG No data
Right 993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
993367467_993367470 11 Left 993367467 5:87050947-87050969 CCAGTAACAGACCAATAGCTGTG No data
Right 993367470 5:87050981-87051003 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993367467 Original CRISPR CACAGCTATTGGTCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr