ID: 993369981

View in Genome Browser
Species Human (GRCh38)
Location 5:87080825-87080847
Sequence CCTTCAAACCATGAGTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993369977_993369981 19 Left 993369977 5:87080783-87080805 CCCTTAGAAAGACTTTTTAGGCC No data
Right 993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG No data
993369975_993369981 30 Left 993369975 5:87080772-87080794 CCTCTTTCAATCCCTTAGAAAGA No data
Right 993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG No data
993369978_993369981 18 Left 993369978 5:87080784-87080806 CCTTAGAAAGACTTTTTAGGCCT No data
Right 993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG No data
993369979_993369981 -2 Left 993369979 5:87080804-87080826 CCTTATAGAGATTTAACATTTCC No data
Right 993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993369981 Original CRISPR CCTTCAAACCATGAGTTGTT TGG Intergenic
No off target data available for this crispr