ID: 993372409

View in Genome Browser
Species Human (GRCh38)
Location 5:87108941-87108963
Sequence CCACCACTACATGAGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993372409_993372411 -8 Left 993372409 5:87108941-87108963 CCATGTTTCTCATGTAGTGGTGG No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993372409 Original CRISPR CCACCACTACATGAGAAACA TGG (reversed) Intergenic
No off target data available for this crispr