ID: 993372411

View in Genome Browser
Species Human (GRCh38)
Location 5:87108956-87108978
Sequence AGTGGTGGTATTCAGACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993372404_993372411 17 Left 993372404 5:87108916-87108938 CCCCACATTACTTATTCCTCAAA No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data
993372407_993372411 1 Left 993372407 5:87108932-87108954 CCTCAAAGTCCATGTTTCTCATG No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data
993372406_993372411 15 Left 993372406 5:87108918-87108940 CCACATTACTTATTCCTCAAAGT No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data
993372405_993372411 16 Left 993372405 5:87108917-87108939 CCCACATTACTTATTCCTCAAAG No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data
993372409_993372411 -8 Left 993372409 5:87108941-87108963 CCATGTTTCTCATGTAGTGGTGG No data
Right 993372411 5:87108956-87108978 AGTGGTGGTATTCAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993372411 Original CRISPR AGTGGTGGTATTCAGACCAC CGG Intergenic
No off target data available for this crispr