ID: 993373423

View in Genome Browser
Species Human (GRCh38)
Location 5:87119810-87119832
Sequence TGGGGCTTCTATGCACAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993373423_993373430 -4 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373430 5:87119829-87119851 CCCACTTGGGAGGCACTGCTGGG No data
993373423_993373436 21 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373436 5:87119854-87119876 AGACATCCTAGGTGGGGAAGTGG No data
993373423_993373433 13 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373433 5:87119846-87119868 GCTGGGAAAGACATCCTAGGTGG No data
993373423_993373435 15 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373435 5:87119848-87119870 TGGGAAAGACATCCTAGGTGGGG No data
993373423_993373428 -5 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373428 5:87119828-87119850 CCCCACTTGGGAGGCACTGCTGG No data
993373423_993373439 29 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373439 5:87119862-87119884 TAGGTGGGGAAGTGGAGCATGGG No data
993373423_993373432 10 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373432 5:87119843-87119865 ACTGCTGGGAAAGACATCCTAGG No data
993373423_993373438 28 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373438 5:87119861-87119883 CTAGGTGGGGAAGTGGAGCATGG No data
993373423_993373434 14 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993373423 Original CRISPR TGGGGCTTCTATGCACAACT TGG (reversed) Intergenic
No off target data available for this crispr