ID: 993373431

View in Genome Browser
Species Human (GRCh38)
Location 5:87119830-87119852
Sequence TCCCAGCAGTGCCTCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993373431_993373432 -10 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373432 5:87119843-87119865 ACTGCTGGGAAAGACATCCTAGG No data
993373431_993373439 9 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373439 5:87119862-87119884 TAGGTGGGGAAGTGGAGCATGGG No data
993373431_993373444 28 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373444 5:87119881-87119903 TGGGTGGAGCTTGGTGGGCAAGG No data
993373431_993373438 8 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373438 5:87119861-87119883 CTAGGTGGGGAAGTGGAGCATGG No data
993373431_993373445 29 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373445 5:87119882-87119904 GGGTGGAGCTTGGTGGGCAAGGG No data
993373431_993373435 -5 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373435 5:87119848-87119870 TGGGAAAGACATCCTAGGTGGGG No data
993373431_993373434 -6 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data
993373431_993373440 12 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373440 5:87119865-87119887 GTGGGGAAGTGGAGCATGGGTGG No data
993373431_993373442 22 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373442 5:87119875-87119897 GGAGCATGGGTGGAGCTTGGTGG No data
993373431_993373441 19 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373441 5:87119872-87119894 AGTGGAGCATGGGTGGAGCTTGG No data
993373431_993373433 -7 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373433 5:87119846-87119868 GCTGGGAAAGACATCCTAGGTGG No data
993373431_993373443 23 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373443 5:87119876-87119898 GAGCATGGGTGGAGCTTGGTGGG No data
993373431_993373436 1 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373436 5:87119854-87119876 AGACATCCTAGGTGGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993373431 Original CRISPR TCCCAGCAGTGCCTCCCAAG TGG (reversed) Intergenic
No off target data available for this crispr