ID: 993373434

View in Genome Browser
Species Human (GRCh38)
Location 5:87119847-87119869
Sequence CTGGGAAAGACATCCTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993373423_993373434 14 Left 993373423 5:87119810-87119832 CCAAGTTGTGCATAGAAGCCCCA No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data
993373427_993373434 -4 Left 993373427 5:87119828-87119850 CCCCACTTGGGAGGCACTGCTGG No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data
993373431_993373434 -6 Left 993373431 5:87119830-87119852 CCACTTGGGAGGCACTGCTGGGA No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data
993373429_993373434 -5 Left 993373429 5:87119829-87119851 CCCACTTGGGAGGCACTGCTGGG No data
Right 993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993373434 Original CRISPR CTGGGAAAGACATCCTAGGT GGG Intergenic
No off target data available for this crispr