ID: 993379000

View in Genome Browser
Species Human (GRCh38)
Location 5:87184041-87184063
Sequence CAGTAGGAATGAATGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993379000_993379004 2 Left 993379000 5:87184041-87184063 CCAATTTCCATTCATTCCTACTG No data
Right 993379004 5:87184066-87184088 TTCTGTTATCCCAACAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993379000 Original CRISPR CAGTAGGAATGAATGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr