ID: 993389226

View in Genome Browser
Species Human (GRCh38)
Location 5:87297909-87297931
Sequence CCAAGGAAGTTTCTGCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993389216_993389226 26 Left 993389216 5:87297860-87297882 CCAGCAATTTGTCATTATAGTTG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 993389226 5:87297909-87297931 CCAAGGAAGTTTCTGCTTGTGGG 0: 1
1: 1
2: 5
3: 30
4: 196
993389222_993389226 -9 Left 993389222 5:87297895-87297917 CCTGGCACTGGTTCCCAAGGAAG 0: 1
1: 1
2: 10
3: 47
4: 247
Right 993389226 5:87297909-87297931 CCAAGGAAGTTTCTGCTTGTGGG 0: 1
1: 1
2: 5
3: 30
4: 196
993389221_993389226 -8 Left 993389221 5:87297894-87297916 CCCTGGCACTGGTTCCCAAGGAA 0: 1
1: 0
2: 11
3: 39
4: 243
Right 993389226 5:87297909-87297931 CCAAGGAAGTTTCTGCTTGTGGG 0: 1
1: 1
2: 5
3: 30
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993389226 Original CRISPR CCAAGGAAGTTTCTGCTTGT GGG Intronic