ID: 993392708

View in Genome Browser
Species Human (GRCh38)
Location 5:87340615-87340637
Sequence GTTCAAAACATAGTAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993392708 Original CRISPR GTTCAAAACATAGTAAAAGG GGG Intronic
903085497 1:20853900-20853922 TTTAAAAACATAGTAAACAGGGG + Intronic
903112439 1:21147625-21147647 GTTCAAAACTTAGCAAAGGTTGG - Intronic
903362547 1:22785806-22785828 GCTCAGCACATAGTACAAGGGGG - Intronic
904362191 1:29983494-29983516 GTTCAGATCAATGTAAAAGGAGG - Intergenic
904547498 1:31287528-31287550 TTTCAGAAGATAGTAAGAGGTGG - Intronic
905947691 1:41917675-41917697 ATTTAAAAGATAGTAAAATGTGG + Intronic
906496575 1:46308529-46308551 GTACAAAACTTAGATAAAGGAGG + Intronic
908525084 1:64980287-64980309 GTGCAAAACAGAGTAGAATGAGG - Intergenic
908873440 1:68641950-68641972 GTTCAAAACATAGTAGGATTAGG - Intergenic
909269359 1:73602564-73602586 TTTCAAAACCTAGCAAAAGAGGG - Intergenic
909496090 1:76280171-76280193 ATTCAGAACATAGCAAAGGGTGG - Intronic
912527972 1:110298872-110298894 GATAAAAACAGAGGAAAAGGGGG + Intergenic
915434039 1:155889758-155889780 GTTCAAGTCATAGAAATAGGGGG + Intergenic
917782612 1:178414200-178414222 GTTCAAACCATCTTAAATGGGGG + Intronic
919056923 1:192582662-192582684 GGAAAAAATATAGTAAAAGGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
922632451 1:227130440-227130462 GTTCAAAACATACTAAAAACTGG + Intronic
923103949 1:230839755-230839777 GTAAAATACATAGGAAAAGGTGG + Exonic
923692955 1:236214188-236214210 CTCCTAAACATATTAAAAGGTGG + Intronic
923913180 1:238472424-238472446 TTTTAAAAGATAGTAAAATGTGG + Intergenic
1065252825 10:23834215-23834237 GTTCAAAACATAATAAGATCTGG - Intronic
1068217493 10:54001377-54001399 TTTCAAGACATAGTAAAATAAGG + Intronic
1069020588 10:63483622-63483644 TTTCAAAAAATGGCAAAAGGGGG - Intergenic
1071040266 10:81300167-81300189 GTTCACAACTTAGTGAAAGATGG - Intergenic
1073669280 10:105569344-105569366 GTTAAAAACAAAATAAAATGTGG + Intergenic
1074992509 10:118722708-118722730 GTTCTCAACTTAGTAATAGGAGG + Intronic
1077810904 11:5635554-5635576 GTTTAAAAAAAAGTAACAGGGGG - Intronic
1079041168 11:17061223-17061245 TTCCAAAAAATAGTAAGAGGGGG + Intergenic
1079475734 11:20827195-20827217 CTTCCAATCATAGTATAAGGGGG - Intronic
1080445294 11:32332595-32332617 TCTCAAAACCTAGTACAAGGCGG + Intergenic
1080685518 11:34511954-34511976 GTGCAAAATATAGAAAAAAGTGG + Intronic
1080782731 11:35445868-35445890 ATTCAAAACAATGGAAAAGGAGG - Intronic
1084144368 11:67256278-67256300 GTTCAATGCAAAGTAAAAGGGGG - Exonic
1085139196 11:74124867-74124889 TTTCAAAAAAGAGTAAAAAGTGG - Intronic
1085455514 11:76663282-76663304 TTTCAAAATATAGTCAAAGACGG + Intronic
1085601127 11:77856901-77856923 GTTGAAAACAGAATACAAGGTGG + Intronic
1086646365 11:89226544-89226566 GTTCAAAAGGAGGTAAAAGGAGG + Intronic
1087349771 11:97017086-97017108 GTTCAGAGCATAAGAAAAGGAGG + Intergenic
1088126343 11:106428960-106428982 TTTTAAAACCTAGTAAATGGGGG - Intergenic
1089418467 11:118313558-118313580 GTTCTAAACATATTGAAGGGGGG + Intronic
1091576595 12:1742394-1742416 TTTCTAAACATAGAAAAAAGTGG - Intronic
1093307990 12:17543479-17543501 GATGAAAACATAATAAAAGAGGG - Intergenic
1093322614 12:17732517-17732539 TTTTAAAAAAAAGTAAAAGGAGG - Intergenic
1093438780 12:19168777-19168799 GTCAGAAACACAGTAAAAGGTGG + Intronic
1093877069 12:24361362-24361384 GTTCAATAGCTAGTAAGAGGTGG - Intergenic
1097607391 12:61772334-61772356 TTCCAAAACATAGAAAAAGAGGG + Intronic
1098246544 12:68524988-68525010 CTTCCAAACATGGTAGAAGGTGG - Intergenic
1098721051 12:73898226-73898248 TTTAAAAACATAGTAGAAGAAGG - Intergenic
1099365081 12:81758692-81758714 GTTCAGACCATTGTCAAAGGAGG + Intronic
1101084828 12:101225445-101225467 TTTCAAAACATATTAAGTGGAGG - Intergenic
1104572774 12:129939749-129939771 TTTTAAGACATAGAAAAAGGAGG - Intergenic
1104823276 12:131690997-131691019 TTTTAAAACATAGGAAACGGTGG + Intergenic
1107919656 13:45191069-45191091 TTTAAAAATATAGTAAAAGCCGG + Intronic
1108062815 13:46550344-46550366 TTTCAAAAAATAACAAAAGGAGG - Intergenic
1110457473 13:75705812-75705834 TCTCAAAACATAGTGAAAGTAGG - Intronic
1110483392 13:76010232-76010254 ATTCTAAAAATAGAAAAAGGAGG + Intergenic
1111064872 13:83076899-83076921 TTTCAAAACAATGTAATAGGAGG + Intergenic
1112654233 13:101432672-101432694 ATTGAAAACCTAGTAAAAGATGG - Intergenic
1112676992 13:101713344-101713366 GTTCAAAATATATTGAAAAGGGG - Exonic
1112724265 13:102284044-102284066 ATTTAAAAAATAGTAAAGGGTGG + Intronic
1113549222 13:111178963-111178985 TTTCAAAACAAAAAAAAAGGGGG - Intronic
1114367592 14:22046541-22046563 GTTAAAATCAAAGAAAAAGGAGG + Intergenic
1114467528 14:22934105-22934127 GTTCTGAACATAGAAAAAGATGG + Intergenic
1115658185 14:35464304-35464326 TTTCAATTCATAGTAAAAAGGGG + Intergenic
1116313198 14:43352608-43352630 ATTCTAAATATAGAAAAAGGGGG + Intergenic
1116620930 14:47202317-47202339 GCTATAAACCTAGTAAAAGGTGG + Intronic
1117570451 14:57043804-57043826 GTTCAAAACAGAGTATACTGTGG + Intergenic
1118186774 14:63544418-63544440 GTTCAAAACTTAGAAATTGGGGG + Intergenic
1120634949 14:86939904-86939926 GTTCAAAAAACAGAAAAATGTGG + Intergenic
1122183114 14:99970308-99970330 GTCCAAGATATAGTAAATGGTGG - Intergenic
1122222009 14:100245429-100245451 ATTCAAAACATAGTTGAAGCTGG - Intronic
1122339087 14:101015130-101015152 GTACAGAACATAGAAAAAGATGG - Intergenic
1125715270 15:41816455-41816477 GTTCAAAAAAAGGAAAAAGGAGG + Intronic
1126194406 15:45916237-45916259 GTTCAAAATACAATAAAAGTTGG - Intergenic
1126547376 15:49887995-49888017 CTGCAACACATAGGAAAAGGGGG - Intronic
1127116542 15:55733204-55733226 TCTCAAAAAATAGTAAATGGAGG + Intronic
1130188842 15:81712359-81712381 ATTCAAAACAAAATAACAGGGGG - Intergenic
1134544218 16:15095197-15095219 GTTCCAAGCATAGGAAACGGAGG + Intronic
1135816743 16:25641235-25641257 GTTCAGAATATGATAAAAGGTGG - Intergenic
1137518956 16:49175254-49175276 GCTCAAAACCTAGTAGAAGAGGG - Intergenic
1140655593 16:77136192-77136214 GTTTGGAACATAGTAATAGGTGG - Intergenic
1144200863 17:12941208-12941230 GATCACATCATAGAAAAAGGTGG + Intronic
1144370460 17:14585300-14585322 TTTGAAAACATAGCAAAAGGAGG - Intergenic
1146324302 17:31872365-31872387 GTTCAAAAAAAAGAAAAAGAAGG + Intronic
1148097020 17:45059559-45059581 GTTAAAAACAGATTAAAATGTGG + Intronic
1149972539 17:61233504-61233526 GATCAAAACACAGTAAATGAAGG + Intronic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1151900012 17:77006022-77006044 GTTGAAAAAAAAATAAAAGGAGG - Intergenic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1154112403 18:11581467-11581489 GTTCAAACCATATTCAAATGAGG - Intergenic
1158051436 18:53225638-53225660 TTTCAAAACAGGGAAAAAGGTGG + Intronic
1158091281 18:53716625-53716647 GTACAAAACACTGGAAAAGGGGG + Intergenic
1159282242 18:66301344-66301366 GCCCAAAACTTAATAAAAGGAGG + Intergenic
1159504753 18:69321455-69321477 TTTCAAAACATAGTATAATAAGG - Intergenic
1160888339 19:1363048-1363070 GTTGCAAAAATAGTAAAGGGAGG + Intronic
1162048289 19:8016156-8016178 GTTCCAAAGATTGTAAAAGTGGG - Intronic
1162707905 19:12569313-12569335 GTTCAAAACATAGTACCAGCCGG - Intronic
1162986542 19:14274014-14274036 GTTCGAAACATGCTAGAAGGAGG - Intergenic
1165936671 19:39393394-39393416 GTTCAAAAAAAAAGAAAAGGAGG - Intronic
1166815872 19:45545227-45545249 CTTCAAAACAGAGAAAAAAGGGG + Intronic
1168525708 19:57087451-57087473 GTTCAAAACATACTGAAAAGGGG + Intergenic
1168701787 19:58444304-58444326 GTTCAAGACACATTAAAGGGAGG - Intergenic
925529400 2:4842744-4842766 GTTCAATACATAACAGAAGGTGG + Intergenic
926637449 2:15197719-15197741 GTTAGAAACATAGTAATGGGAGG - Intronic
927005608 2:18844834-18844856 ATTTAAAACTTAGTAAAATGTGG - Intergenic
928583515 2:32732583-32732605 TTTCAAAAAATAGTAAAAAAGGG - Intronic
930624654 2:53683083-53683105 GCTCATATCATAGTGAAAGGGGG - Intronic
931253414 2:60552001-60552023 TTCCAAAAAATAGTAAGAGGAGG + Intronic
931624781 2:64247370-64247392 GTTAAGAACATGGGAAAAGGAGG + Intergenic
932825724 2:74937972-74937994 GTTGAAAGAATAGTAAAATGAGG - Intergenic
932985327 2:76719690-76719712 CTTCAGAACAAAATAAAAGGGGG - Intergenic
933562839 2:83910392-83910414 TTTCAAAACCTATTAAAAGCTGG - Intergenic
933690257 2:85174186-85174208 GTCCAGAACATAGAAAAAGAAGG - Intronic
934588061 2:95523086-95523108 GTTCAATACATTAAAAAAGGTGG + Intergenic
934955717 2:98616560-98616582 GTTGAGAACATAGCAAGAGGGGG + Intronic
937688009 2:124720345-124720367 TTTCAGAAAATAGTCAAAGGGGG - Intronic
938976986 2:136488552-136488574 GTTTAAAATATAGTAAATGCAGG + Intergenic
939088580 2:137751552-137751574 GTGCAATATATAGTAAAAGAGGG + Intergenic
939387090 2:141514718-141514740 GTTCATAACATGTTTAAAGGAGG - Intronic
939714979 2:145572389-145572411 GTTCAAAGAATAGTAAAGAGTGG + Intergenic
940024562 2:149192498-149192520 GGTCAAAGCATGGTGAAAGGTGG + Intronic
940228929 2:151429973-151429995 ATACAAAACATATTAAAAGGAGG - Intronic
940231012 2:151451793-151451815 GATCAAAAGTTAGTAAAATGAGG - Intronic
942984703 2:182125434-182125456 ATTCCAAACATAGAAAAAGAGGG - Intronic
943269357 2:185777883-185777905 GTTTATAAAATAGTAAAAGCAGG - Intronic
943670202 2:190651803-190651825 GTTCAAAACATATTATAAAATGG - Intronic
943969729 2:194388316-194388338 ATTCAAAATATACTAAAAGCAGG - Intergenic
946158623 2:217822670-217822692 GTTCAAAACAGCCTAAGAGGGGG + Intronic
946690315 2:222304382-222304404 TTTTAAAAAATAATAAAAGGAGG + Exonic
1169751437 20:8998665-8998687 ATTTAAAACATTGTAAAAGAAGG - Intergenic
1170753947 20:19180327-19180349 GTTCAAAATAAAGCAGAAGGTGG + Intergenic
1173154279 20:40594666-40594688 GGTCAAAACATAGCAGAAGCTGG + Intergenic
1174999165 20:55607397-55607419 ATACAAAATAGAGTAAAAGGGGG - Intergenic
1178737660 21:35167308-35167330 GCTTAAAACCAAGTAAAAGGGGG - Intronic
1183286903 22:36972168-36972190 GTTCTGAAAATAATAAAAGGTGG + Intergenic
949467410 3:4357988-4358010 GTTCAAAAAAAAGTAAAAGGTGG + Intronic
949563619 3:5225502-5225524 GTTGCAAATATAGTTAAAGGAGG - Intergenic
953146796 3:40284664-40284686 TTTCAAAGCATCGTAAAAGATGG - Intergenic
954028050 3:47798697-47798719 GTTAAAGACAGAGTTAAAGGTGG + Intergenic
955683943 3:61531166-61531188 GTACTAAACATAGAAAAAGATGG + Intergenic
955756298 3:62228220-62228242 TTACAAAACAAAGAAAAAGGAGG + Intronic
956975985 3:74580338-74580360 GTTCAAAACATAGAGGAAGAAGG + Intergenic
957381166 3:79431529-79431551 TTTCAAAAGAGAATAAAAGGTGG + Intronic
957676120 3:83367121-83367143 GTACAAGACATACTAAAAAGGGG + Intergenic
957747297 3:84362461-84362483 ATTCCAAACATAGAAAAAGAGGG - Intergenic
958544874 3:95532878-95532900 ATTTAAAAGATAATAAAAGGTGG - Intergenic
958782128 3:98555556-98555578 GTTTAAAAAATAGAAAAACGGGG + Intronic
958852222 3:99341917-99341939 CTTCCAGACATAGTAAAAGCAGG + Intergenic
958872094 3:99571782-99571804 TTTCAAAATAGAGTAAAAGAGGG - Intergenic
959483942 3:106906737-106906759 GTCCATAACATAGTGAAAAGAGG + Intergenic
960234292 3:115263630-115263652 GTCCAAAACAGAGTGAATGGTGG + Intergenic
962666371 3:137657796-137657818 TTTCAAACCATAGAAAAAGAGGG + Intergenic
962716497 3:138130710-138130732 GTTCTCAACATGGTAAAAAGAGG + Intronic
963506749 3:146195568-146195590 CTTCTCAACATAGTAAAGGGTGG + Intronic
964885870 3:161481718-161481740 TATCAAAACATAGAGAAAGGAGG - Intergenic
965717103 3:171616895-171616917 CTTCAAAACAAACTAAAACGGGG - Intronic
966240381 3:177749310-177749332 ATTCAAACCATAGGACAAGGTGG - Intergenic
968416900 4:445664-445686 ATTAAAAACATAAAAAAAGGAGG + Intronic
968535723 4:1127387-1127409 GGCCATAACATAGCAAAAGGAGG + Intergenic
971935528 4:33142725-33142747 GATCAAAACCTACCAAAAGGCGG - Intergenic
972698918 4:41474927-41474949 GTTCACAACAGATTAAAATGTGG + Intronic
974243940 4:59289667-59289689 GTTCAAAAAATAAAAAAAGAGGG - Intergenic
974664730 4:64945032-64945054 GTTCAAGACAAAGTATAAGCAGG - Intergenic
974990229 4:69078333-69078355 ATTCCAAACATAGAAAAAGAGGG - Intronic
975696578 4:77019879-77019901 ATTCAAAACAGAGGAAAAGGAGG - Intronic
975731566 4:77342670-77342692 GCTAGAAACATAGTACAAGGAGG + Intronic
975769554 4:77706624-77706646 GTTAAAAACATATTAAAATGTGG - Intergenic
976987117 4:91315346-91315368 GTTCATAACATATTACAAGGAGG - Intronic
977040302 4:92008178-92008200 GTTCCAAACAAAGTGAAAGCAGG - Intergenic
977107944 4:92914332-92914354 GTTAAAAACATAGTATAAGAGGG - Intronic
977380653 4:96269600-96269622 TTTCAAAAAATAGGCAAAGGAGG - Intergenic
978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG + Intronic
979832122 4:125316093-125316115 TTCAAAAACAAAGTAAAAGGGGG + Intergenic
981086990 4:140694181-140694203 GTTCAAAATACAGTAATAGTAGG + Intronic
981321038 4:143391566-143391588 TTTCAAAGCACAGAAAAAGGCGG + Intronic
982855538 4:160377662-160377684 ATGGGAAACATAGTAAAAGGGGG - Intergenic
983481656 4:168281624-168281646 GGTAAAAGCATAGTAAAAGTGGG - Intronic
983964772 4:173796696-173796718 GTCCAAAATAGAGTAAATGGTGG + Intergenic
984543990 4:181076601-181076623 GTTAAAAACAACGTAAAAGCAGG - Intergenic
985980125 5:3455991-3456013 ATTCAAGACAGAGTAAAAGTGGG + Intergenic
986889153 5:12279118-12279140 GTTTAAAAAATAGTGAAAGTGGG - Intergenic
987819212 5:22940562-22940584 TTACAAAACATGCTAAAAGGAGG - Intergenic
988868565 5:35362171-35362193 GTTCAAATCAAAGTCAAAGCTGG - Intergenic
989006863 5:36824546-36824568 TTTCAAAAGATAGTGAAAGAGGG - Intergenic
989813620 5:45709010-45709032 GTTCAAAATGTAGAAAAAGCAGG - Intergenic
989998019 5:50858778-50858800 GTTAAAAACAAAACAAAAGGTGG - Intergenic
990237296 5:53781864-53781886 GGTCAAAATATAGAACAAGGTGG + Intergenic
990417900 5:55604187-55604209 GTTCAAACCATGCTAAAAGAAGG - Intergenic
993216212 5:85025673-85025695 ATTAAAAACAAAATAAAAGGTGG - Intergenic
993392708 5:87340615-87340637 GTTCAAAACATAGTAAAAGGGGG + Intronic
993403015 5:87476150-87476172 ATTCAAAAAATAGAAAAAGAGGG + Intergenic
994716904 5:103332732-103332754 TATCAAATCATAGTAACAGGAGG - Intergenic
994852120 5:105069044-105069066 GCTCAGAAGAGAGTAAAAGGGGG + Intergenic
994923409 5:106082158-106082180 GGTCAAAAACAAGTAAAAGGTGG - Intergenic
995225257 5:109693312-109693334 ATACCAAACATAGCAAAAGGAGG + Intronic
995351386 5:111179843-111179865 TTTCAAAAGATAGTGAAAGAGGG - Intergenic
999138146 5:149337411-149337433 ATTAGAAACATAATAAAAGGGGG + Intronic
999999934 5:157128151-157128173 CTTCAAAACATATTACAAAGCGG + Intronic
1000747339 5:165050337-165050359 GTTGAAAACATAGTAATATTAGG - Intergenic
1002387835 5:178882330-178882352 GTTCAGAATGTAGGAAAAGGAGG + Intronic
1006269792 6:32955279-32955301 GTTCAAAACACAGTAGAGGAGGG + Intronic
1007081784 6:39110671-39110693 TTGCAAAACACAGCAAAAGGTGG + Intronic
1007253652 6:40513532-40513554 GTTCAAAAAATTGTTAAATGAGG - Intronic
1008172943 6:48232957-48232979 ATACAAAACATATTAACAGGGGG + Intergenic
1008431469 6:51422585-51422607 TTTCAAAAGAAAGAAAAAGGGGG + Intergenic
1009832952 6:68962619-68962641 AATAAAAAAATAGTAAAAGGTGG - Intronic
1010259527 6:73799260-73799282 GTTCAAAACATAAACAAAAGTGG - Intronic
1011423069 6:87195212-87195234 GTGCAAAAGATAGTAAAAGGAGG + Intronic
1012585613 6:100918595-100918617 GTACAAAACATAGCAATAGAAGG - Intergenic
1012652567 6:101774422-101774444 GTTCCAAATGTAGTAAAAAGCGG + Intronic
1014085127 6:117333449-117333471 GTTCCAAACAATGGAAAAGGAGG + Intronic
1021385905 7:20029678-20029700 ATTCAAAGCAGAGTAAAAAGAGG - Intergenic
1021827366 7:24568737-24568759 GTTCAGGAGATGGTAAAAGGAGG + Intergenic
1021830870 7:24608256-24608278 GTTTAAAACATAAAAAAATGGGG - Intronic
1022446106 7:30471955-30471977 GCTCAAAACAAAGTGAAAGAAGG - Intronic
1023285020 7:38609897-38609919 GTTCAAAAACCAGTAAAAGGAGG + Intronic
1025618748 7:63148440-63148462 TTTGAAAAAATAGAAAAAGGAGG + Intergenic
1027340321 7:77200826-77200848 ATGCAAAACAAATTAAAAGGAGG - Intronic
1027928807 7:84503805-84503827 ATTTAAAAGATAATAAAAGGAGG - Intergenic
1028306187 7:89268281-89268303 GATAAAAACATAGAAAGAGGAGG - Intronic
1030993472 7:116329489-116329511 ATTCAAAATATATTTAAAGGAGG - Intronic
1031686933 7:124741926-124741948 TGTGAAAACATAGTAAACGGTGG + Intergenic
1032372538 7:131372541-131372563 GTTCAATACATAGTAAGTGAAGG - Intronic
1032676270 7:134132707-134132729 GTTCAAAACACAGACAAAAGGGG + Intronic
1035795425 8:2352091-2352113 GTTGAAATAATGGTAAAAGGAGG + Intergenic
1037464540 8:19147461-19147483 GTTCAGAACAATGTAAAAAGAGG + Intergenic
1037739073 8:21590890-21590912 GTCCATAATCTAGTAAAAGGAGG + Intergenic
1039146432 8:34451973-34451995 GTTAAAAACACAGGAATAGGAGG + Intergenic
1041372671 8:57179466-57179488 GTTTAAAATAAAGTAAAAGGTGG + Intergenic
1041843846 8:62304416-62304438 TTACAAATCATACTAAAAGGGGG - Intronic
1041966081 8:63678710-63678732 TTTCAGAAAATAGAAAAAGGGGG - Intergenic
1044256383 8:90068021-90068043 GTTCTAAAAATAGAAAAAGTAGG + Intronic
1044830909 8:96247420-96247442 ATCTAAAACATAGTAAAAGATGG + Intronic
1044955339 8:97474385-97474407 CTTCAAAAAATATAAAAAGGAGG - Intergenic
1045968705 8:108055582-108055604 GTTCAAAACATACTGAAAAGAGG + Intronic
1046164300 8:110409972-110409994 GTGAAAATCATAATAAAAGGGGG - Intergenic
1046692286 8:117299196-117299218 GTGCATCACATAGTGAAAGGAGG - Intergenic
1046800348 8:118419678-118419700 GTTCAGCACATAGAAAAATGGGG - Intronic
1048913724 8:139161993-139162015 ATTCCAAACATAGAAAAAGAGGG - Intergenic
1050200875 9:3144454-3144476 GTTCCAAAAATAGAAAAAGAGGG - Intergenic
1052128454 9:24809322-24809344 GTTCAAAAGACAGTCAAGGGTGG + Intergenic
1058026736 9:100148327-100148349 GTTCAAAAAATAATATAAAGAGG - Intronic
1058111922 9:101040043-101040065 ATTCAGAACATAGCAAGAGGTGG + Intronic
1061981394 9:134106035-134106057 CTTCAAAACATACTACAAAGTGG + Intergenic
1185697816 X:2208525-2208547 ATTAAAAACAAAGAAAAAGGAGG - Intergenic
1186166783 X:6834973-6834995 ATTCAAACCATAGCAAAAGGTGG + Intergenic
1186228629 X:7428767-7428789 GATCAACACATGGTAAAATGTGG - Intergenic
1186295936 X:8148490-8148512 CTTCAACACAAAGTAAAAAGAGG - Intergenic
1186567163 X:10675962-10675984 GTTCAAGACACTGTGAAAGGAGG - Intronic
1188964015 X:36528368-36528390 TTTCAAAATATAATAAAAGCAGG + Intergenic
1189461055 X:41243455-41243477 GTTCAAAAAAAAAAAAAAGGAGG + Intergenic
1191130970 X:57010223-57010245 TTTCAATACATAGTACAAGAAGG - Intergenic
1191855595 X:65623455-65623477 TTTCAAAAAATAGAAGAAGGGGG - Intronic
1193352138 X:80475627-80475649 GATCAAAACAAAGTAAGAGTTGG - Intergenic
1193364813 X:80619694-80619716 GTTCCAAACAAAAGAAAAGGAGG - Intergenic
1193911877 X:87316398-87316420 GCTCAGAACATAGAGAAAGGGGG - Intergenic
1195883834 X:109619998-109620020 TTTCAAAACATAGCAGATGGAGG + Intergenic
1196255034 X:113507430-113507452 AGTCAAAACCTAGTAAATGGTGG - Intergenic
1196586810 X:117439595-117439617 GTTTAAAACATAGTCAAACACGG - Intergenic
1196800095 X:119535007-119535029 GTTGATAACATTGTAAAATGTGG + Intergenic
1197313179 X:124931295-124931317 TTTCAAAAGATTCTAAAAGGAGG + Intronic
1198201722 X:134427161-134427183 CTTCTAAAAATAGTAAAAGATGG - Exonic
1199551777 X:149068882-149068904 GGTTAAAGCATAGTAAATGGAGG - Intergenic
1199730101 X:150623330-150623352 GTTGCAAAGATAATAAAAGGAGG - Intronic
1199746555 X:150775540-150775562 TTTAAAAACCTAGTAAAGGGTGG + Intronic
1201597034 Y:15681591-15681613 GGTCAATACATTGTAAAAGATGG - Intergenic
1201714609 Y:17030693-17030715 GCTCAAAACATATTACAATGAGG + Intergenic