ID: 993395597

View in Genome Browser
Species Human (GRCh38)
Location 5:87383232-87383254
Sequence TTAAACAGAACAGCCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993395597_993395598 -5 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA No data
Right 993395598 5:87383250-87383272 TTTAAATAAATTAAGAAATGAGG 0: 1
1: 0
2: 20
3: 200
4: 1779
993395597_993395599 -4 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA No data
Right 993395599 5:87383251-87383273 TTAAATAAATTAAGAAATGAGGG 0: 1
1: 0
2: 23
3: 283
4: 2818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993395597 Original CRISPR TTAAACAGAACAGCCTAAGT TGG (reversed) Intronic