ID: 993395597

View in Genome Browser
Species Human (GRCh38)
Location 5:87383232-87383254
Sequence TTAAACAGAACAGCCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993395597_993395599 -4 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA 0: 1
1: 0
2: 2
3: 11
4: 144
Right 993395599 5:87383251-87383273 TTAAATAAATTAAGAAATGAGGG 0: 1
1: 0
2: 23
3: 283
4: 2818
993395597_993395598 -5 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA 0: 1
1: 0
2: 2
3: 11
4: 144
Right 993395598 5:87383250-87383272 TTTAAATAAATTAAGAAATGAGG 0: 1
1: 0
2: 20
3: 200
4: 1779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993395597 Original CRISPR TTAAACAGAACAGCCTAAGT TGG (reversed) Intronic
901747047 1:11380783-11380805 TTAAACATAACAGGCAAGGTGGG + Intergenic
904031360 1:27535491-27535513 TTCCTCAGAACAGCCTAAGTTGG - Intronic
904680423 1:32225270-32225292 CTAAACAGAACAGCTTAGGCTGG - Intronic
920084637 1:203406348-203406370 CCAAACAGACCATCCTAAGTGGG - Intergenic
921417083 1:214900984-214901006 TCAAAAAGAACAGCAGAAGTTGG - Intergenic
922655529 1:227379277-227379299 TTGGACAGAACAGCTAAAGTGGG - Intergenic
922659562 1:227418163-227418185 GTTAGCAGAAGAGCCTAAGTTGG + Intergenic
922820604 1:228482825-228482847 CTAATGAGAAGAGCCTAAGTGGG - Intergenic
923193698 1:231644111-231644133 TTAAACAGAAATGACCAAGTTGG - Intronic
924024972 1:239822429-239822451 TTAACCAGAACATCCAAAGGTGG + Intronic
1073641172 10:105254027-105254049 TTAGGGACAACAGCCTAAGTCGG + Intronic
1074170223 10:110926120-110926142 TCAAACAGAAGAACCTAACTAGG - Intronic
1074242858 10:111656356-111656378 TTAGACAGAAAATACTAAGTAGG + Intergenic
1074575179 10:114662334-114662356 CTAAACAGAACAGATTCAGTGGG + Intronic
1076576487 10:131473367-131473389 TGGGACAGAACAGCCTCAGTGGG + Intergenic
1078657906 11:13259586-13259608 TTAAACAAAACTGCCTCAGAGGG - Intergenic
1079235838 11:18689572-18689594 TTAAAAAAAAGAGCCTATGTGGG + Intergenic
1080149354 11:29030746-29030768 TTAAAAAAAACAGAATAAGTTGG + Intergenic
1080497508 11:32834227-32834249 TTTAACATAACAGCCAAAGAGGG - Intronic
1081892880 11:46559002-46559024 TTAAAAAGAAAAACCTAAGCCGG + Intronic
1083690888 11:64408182-64408204 TTCAACAGAACAGCCCAGGCTGG + Intergenic
1085192615 11:74641249-74641271 TTACAGAGAACAGCCTCAGGAGG - Exonic
1085983721 11:81757955-81757977 TTAAATATAACTGCTTAAGTGGG - Intergenic
1087229754 11:95647094-95647116 TTAAAGAGAACAGCCTAAGGAGG + Intergenic
1087253924 11:95934455-95934477 TTACACAGAAGAGCCTCAGAAGG + Intergenic
1087445803 11:98251205-98251227 AGATACAGAAAAGCCTAAGTAGG - Intergenic
1087501034 11:98954097-98954119 TTAAACACAAAAGCCTATGGTGG - Intergenic
1087821280 11:102715470-102715492 TTATACATAACAGTCTAAGTAGG + Intronic
1087871375 11:103296920-103296942 TAAAAAGGAACAGCCTAAGAGGG - Intronic
1088149226 11:106724065-106724087 ATAAACAGAACAAGCTAACTTGG + Intronic
1094304524 12:29002997-29003019 TTGAACAGAATAGCTTCAGTTGG - Intergenic
1095460847 12:42443081-42443103 CTACACAGAAGAGCCTAAGAAGG + Intronic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1099551486 12:84050158-84050180 TTAAACACAAGAGGCTAAGAAGG - Intergenic
1100129396 12:91472415-91472437 TTAAACAGAACCTCTTAAGTAGG + Intergenic
1101561387 12:105861053-105861075 TTACAGAGGACAGCCTCAGTGGG + Intergenic
1102400053 12:112620953-112620975 TAAAACAGAACAGGCTGAGGAGG - Intronic
1105442767 13:20429200-20429222 TTTTACAGAAGAGGCTAAGTAGG - Intronic
1110060162 13:71030395-71030417 CTACACAGAAGAGCCTAAGAAGG - Intergenic
1110356525 13:74573906-74573928 TTTAAAAGAAAAGCCTAAGGAGG - Intergenic
1110842517 13:80158679-80158701 GAAAACAGAAATGCCTAAGTTGG - Intergenic
1111642312 13:90984036-90984058 ATAAAAAGAAGAGCCTAATTAGG + Intergenic
1112624079 13:101082656-101082678 TTAAGCAGAACCGCTTAAGTAGG + Intronic
1115816507 14:37170004-37170026 CTCAACAAAACAGCATAAGTAGG + Intronic
1116473777 14:45316448-45316470 TTAAAAATGACAACCTAAGTTGG - Intergenic
1118418263 14:65568568-65568590 ATAAACAGAATAGCCCAATTTGG - Intronic
1122460839 14:101893417-101893439 TTAAAGAGAAAAGCCTATATAGG + Intronic
1122647234 14:103203085-103203107 TTAAAAAGAAAAGCCTAATGGGG + Intergenic
1124917544 15:33990794-33990816 TTAAAAGGAACAGACTAAATTGG + Intronic
1126154065 15:45548746-45548768 TTAAAAAGAAAAGCCTTAGGAGG - Intergenic
1127033290 15:54887706-54887728 ATACACAGAAGAGCCTAAGAAGG + Intergenic
1129759341 15:78120513-78120535 TTAAAGAGCACAGCCTAATTAGG + Intronic
1131342396 15:91614593-91614615 TGAAGCAGAACATGCTAAGTTGG - Intergenic
1132461292 16:56403-56425 TTGTACAGAACAGCCCAGGTAGG + Intronic
1133491562 16:6274848-6274870 TTAAAAAGAACAGCCTATGTAGG - Intronic
1136145115 16:28311979-28312001 GTACACAGAACAGCCTGAGGTGG + Intronic
1139284350 16:65797497-65797519 TTATACAGAATAGCCACAGTGGG - Intergenic
1146094099 17:29911554-29911576 GGAATCAGAACAACCTAAGTTGG - Intronic
1153080878 18:1223323-1223345 ATAAACAGAACAGACTAAAAGGG + Intergenic
1155013204 18:21804114-21804136 TCAATCAGAAAAGCCTTAGTTGG - Intronic
1155344500 18:24845234-24845256 TTATACATAATAGCCTAAGAGGG - Intergenic
1160253943 18:77231125-77231147 TAAAACAGAAAACTCTAAGTGGG - Intergenic
1164295152 19:23903438-23903460 CTATACAGAACAGCCTAAAAAGG + Intergenic
929133891 2:38603933-38603955 TAAAACAGAACATCTTAAGAGGG - Intergenic
929782491 2:44966051-44966073 TTAAACTGAACAGCCTCAAAGGG - Intergenic
931944632 2:67291938-67291960 TTGAAGAGTTCAGCCTAAGTAGG + Intergenic
935429479 2:102959526-102959548 ATAAACAGAACTGCCTACATAGG + Intergenic
935876574 2:107514061-107514083 CAAAAAAAAACAGCCTAAGTGGG + Intergenic
935929018 2:108103512-108103534 TTAAACATAACATCTTAAGCTGG - Intergenic
937194711 2:120142801-120142823 TTAAAAGGAACAGCCTCTGTAGG - Intronic
937626336 2:124048177-124048199 TTAAACAGAACAACATAGATGGG - Intronic
938668116 2:133560365-133560387 TGAAACATAACAGCCTAGATGGG + Intronic
940830540 2:158460045-158460067 TTATACTGAAGAGTCTAAGTTGG + Intronic
941843648 2:170112910-170112932 TTACACAGAAGAGCCTAAAAAGG + Intergenic
942965248 2:181884739-181884761 TTAAACAGGTCAGCCCAAGTTGG - Intergenic
947877241 2:233475834-233475856 AGAAACAGAACAGCTTAAGAAGG + Exonic
1168906690 20:1409694-1409716 TTTGACACAACATCCTAAGTTGG + Intergenic
1171153222 20:22846242-22846264 ATAAACAGAACAGTATATGTAGG + Intergenic
1172680282 20:36708735-36708757 TTAAAAAGCACAGCCCAAGCCGG + Intronic
1172747273 20:37221492-37221514 TTAAAAAGAACAGACTAGGCCGG - Intronic
1173553709 20:43950675-43950697 TTAAACAGAGCAGTCAAGGTGGG - Intronic
1173887179 20:46470017-46470039 TTAAATACAAAAGCCTGAGTGGG - Intergenic
1175077908 20:56391692-56391714 TTAGATAGAATAGCCTAAGAAGG - Intronic
1179777201 21:43672833-43672855 TTAAGCAGAACAAACGAAGTCGG - Intronic
1180717297 22:17880510-17880532 TTAAACAGGCCACCCTAGGTGGG + Intronic
1181872962 22:25916434-25916456 TTAAAGAAAACAGTTTAAGTGGG - Intronic
1185060770 22:48605573-48605595 TTAATCCTAACAGCCTAACTAGG + Intronic
951600836 3:24373012-24373034 AGAAAGAGATCAGCCTAAGTGGG + Intronic
954874306 3:53791434-53791456 TTAAGCAGACCTGCCTAAGGTGG + Intronic
955081951 3:55665985-55666007 TTAAACATCACAGCCTCAGGTGG + Intronic
955110993 3:55949731-55949753 TTAAACAGAGCAGTTCAAGTTGG - Intronic
956244991 3:67172949-67172971 TTAAACAAAACAGAATAACTGGG + Intergenic
963184254 3:142395370-142395392 TTAAACAGGACAGCCTGAATTGG + Intronic
963874621 3:150461462-150461484 TAAAACAGAAAAGCTTATGTGGG - Exonic
965100407 3:164291444-164291466 TTAAACTGAACAGCATATTTTGG + Intergenic
966496988 3:180592378-180592400 TTAAAGAGACCAGCCACAGTAGG + Intergenic
968322291 3:197780331-197780353 TTACACAGAAAATCCTAAGCTGG - Intronic
970506591 4:16736427-16736449 TTAGACAAAAGAGTCTAAGTTGG - Intronic
971691497 4:29842187-29842209 TTAAACGTAACACCTTAAGTTGG + Intergenic
976768463 4:88623331-88623353 GTAATCAAACCAGCCTAAGTAGG - Intronic
976805716 4:89044485-89044507 TAAAGTAGAACAGCCAAAGTGGG + Intronic
978698926 4:111618940-111618962 TTAAATAGCATACCCTAAGTAGG + Intergenic
979176676 4:117673384-117673406 TTAAACACAACAGTGTAAGATGG - Intergenic
980064099 4:128164307-128164329 TTTAACTGAACAGCCCTAGTGGG - Intronic
981754533 4:148127702-148127724 ATAAACACAGCAGCCAAAGTGGG + Intronic
981956190 4:150477307-150477329 CTATAAAGAACAGCCTAAGACGG + Intronic
983958263 4:173722096-173722118 TAAATCAAAACACCCTAAGTTGG + Intergenic
988269972 5:29001736-29001758 TTAAACAGAAAACCCGAAGTGGG - Intergenic
989335925 5:40316707-40316729 ATTAGCAGAACAGTCTAAGTAGG - Intergenic
990342646 5:54838906-54838928 TTCCACATAACAACCTAAGTAGG - Intergenic
992063447 5:73081215-73081237 TTAAACAGAGCAGTCAGAGTAGG + Intronic
992866795 5:80964877-80964899 TGAAACAGAGCAGACTAACTGGG - Intronic
993395597 5:87383232-87383254 TTAAACAGAACAGCCTAAGTTGG - Intronic
993952109 5:94188697-94188719 TTATACATAACAACCAAAGTGGG - Intronic
995261515 5:110109531-110109553 TTAATCAAAACAGGCTAAATTGG - Intergenic
997093825 5:130888110-130888132 TAAAACACAGTAGCCTAAGTTGG + Intergenic
997731927 5:136187797-136187819 TTAAACACAAAAGCCTAATAAGG - Intronic
1000960713 5:167597552-167597574 TTAAACAGAACAGATAAAATAGG + Intronic
1002557241 5:180052224-180052246 TTAAACAGAAAAGCTCAAGAGGG - Intronic
1002882664 6:1266664-1266686 TTAAAAAGAATAGCATCAGTAGG + Intergenic
1003087495 6:3072099-3072121 TTACATAGAACAGCAAAAGTAGG - Intronic
1003278151 6:4669839-4669861 TTACACAGAACAACCAAAGATGG - Intergenic
1012493292 6:99807192-99807214 TTATACTGAAAAGCCTAAGGAGG + Intergenic
1013933109 6:115559215-115559237 AGAAACAGAACAGCCTCAGCAGG - Intergenic
1016359913 6:143256185-143256207 TTAAACAACACTGCCTATGTTGG - Intronic
1021636222 7:22696696-22696718 GGAAGCAGAACGGCCTAAGTGGG - Intergenic
1023401419 7:39794797-39794819 TTAAAAAGTACAGCTTAAGTTGG + Intergenic
1024075400 7:45815441-45815463 TTAAAAAGTACAGCTCAAGTTGG + Intergenic
1025052057 7:55740366-55740388 TTAAAAAGTACAGCTCAAGTTGG - Intergenic
1025129013 7:56366034-56366056 TTAAAAAGTACAGCTCAAGTTGG - Intergenic
1028456441 7:91043004-91043026 TTACACAGAAAAGGCAAAGTGGG - Intronic
1029671396 7:102034246-102034268 TTAAACAAAACAGCCTTCTTGGG - Intronic
1031559724 7:123224001-123224023 TTTTACAGAACAGTTTAAGTAGG + Intergenic
1032063211 7:128742775-128742797 ATAAAGAGAAAAGCCTAACTGGG - Intronic
1037750255 8:21677079-21677101 TTAAACAAGACAGCATAAGTGGG - Intergenic
1040947937 8:52903987-52904009 TTAAACAGTACAGCCAATATGGG + Intergenic
1041200372 8:55448063-55448085 CTAAAAAGAACAGCAAAAGTGGG + Intronic
1041923070 8:63204720-63204742 TAAAACAGAACTGCCGAAGAAGG - Intronic
1045382228 8:101638715-101638737 ATAAAAAGAACAGTCTAATTAGG - Intronic
1047669184 8:127126121-127126143 TTAAACAGCACAGCTTAATATGG + Intergenic
1048447944 8:134506154-134506176 ATAAATAGAACTGCCTAAGAAGG - Intronic
1048718147 8:137291456-137291478 TTCAACAGAGCAGCCAGAGTAGG + Intergenic
1051488778 9:17637725-17637747 ATATTCAGAACAACCTAAGTGGG + Intronic
1055151079 9:73000881-73000903 TAAAACACAACACCCTAAGTTGG - Intronic
1055152439 9:73018887-73018909 TTAAACAGAAGTGGCAAAGTGGG + Intronic
1056037310 9:82620265-82620287 TTTAACAGAGGACCCTAAGTGGG - Intergenic
1061689743 9:132316877-132316899 TTGAAAAGAACAGCATAACTAGG - Intronic
1203656062 Un_KI270752v1:25896-25918 TTAAAAACATCAGCATAAGTCGG + Intergenic
1185745891 X:2573120-2573142 TTAAACAAGACAGCATGAGTGGG - Intergenic
1187315736 X:18193018-18193040 AAAAACAAAACAGCCAAAGTTGG + Intronic
1191862835 X:65679886-65679908 TTAACCAGAGAAGCCTTAGTTGG + Intronic
1196945767 X:120824025-120824047 TAAAGCTTAACAGCCTAAGTGGG + Intergenic
1197655099 X:129108216-129108238 TAAAACAGAACACCCTAAACAGG + Intergenic
1198317207 X:135480038-135480060 TTAAAAAGAAAAGCCTTATTGGG - Intergenic
1200172553 X:154088343-154088365 TTAGACACAACTGACTAAGTGGG + Intronic
1202068674 Y:20968009-20968031 ATACACAGAACAGCCTAAAAAGG + Intergenic
1202381200 Y:24277541-24277563 TTAAAAAGTACAGCTCAAGTTGG + Intergenic
1202489585 Y:25392585-25392607 TTAAAAAGTACAGCTCAAGTTGG - Intergenic