ID: 993395598

View in Genome Browser
Species Human (GRCh38)
Location 5:87383250-87383272
Sequence TTTAAATAAATTAAGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2000
Summary {0: 1, 1: 0, 2: 20, 3: 200, 4: 1779}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993395597_993395598 -5 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA No data
Right 993395598 5:87383250-87383272 TTTAAATAAATTAAGAAATGAGG 0: 1
1: 0
2: 20
3: 200
4: 1779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993395598 Original CRISPR TTTAAATAAATTAAGAAATG AGG Intronic