ID: 993395598 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:87383250-87383272 |
| Sequence | TTTAAATAAATTAAGAAATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2000 | |||
| Summary | {0: 1, 1: 0, 2: 20, 3: 200, 4: 1779} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993395597_993395598 | -5 | Left | 993395597 | 5:87383232-87383254 | CCAACTTAGGCTGTTCTGTTTAA | No data | ||
| Right | 993395598 | 5:87383250-87383272 | TTTAAATAAATTAAGAAATGAGG | 0: 1 1: 0 2: 20 3: 200 4: 1779 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993395598 | Original CRISPR | TTTAAATAAATTAAGAAATG AGG | Intronic | ||