ID: 993395599

View in Genome Browser
Species Human (GRCh38)
Location 5:87383251-87383273
Sequence TTAAATAAATTAAGAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3125
Summary {0: 1, 1: 0, 2: 23, 3: 283, 4: 2818}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993395597_993395599 -4 Left 993395597 5:87383232-87383254 CCAACTTAGGCTGTTCTGTTTAA No data
Right 993395599 5:87383251-87383273 TTAAATAAATTAAGAAATGAGGG 0: 1
1: 0
2: 23
3: 283
4: 2818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993395599 Original CRISPR TTAAATAAATTAAGAAATGA GGG Intronic