ID: 993395599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:87383251-87383273 |
| Sequence | TTAAATAAATTAAGAAATGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3125 | |||
| Summary | {0: 1, 1: 0, 2: 23, 3: 283, 4: 2818} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993395597_993395599 | -4 | Left | 993395597 | 5:87383232-87383254 | CCAACTTAGGCTGTTCTGTTTAA | No data | ||
| Right | 993395599 | 5:87383251-87383273 | TTAAATAAATTAAGAAATGAGGG | 0: 1 1: 0 2: 23 3: 283 4: 2818 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993395599 | Original CRISPR | TTAAATAAATTAAGAAATGA GGG | Intronic | ||