ID: 993402209

View in Genome Browser
Species Human (GRCh38)
Location 5:87467514-87467536
Sequence GTGGCCAGCTTGGCTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993402209_993402212 4 Left 993402209 5:87467514-87467536 CCAATCTCAGCCAAGCTGGCCAC No data
Right 993402212 5:87467541-87467563 TTCCTTCTTCTTCTCGCTTCAGG No data
993402209_993402214 28 Left 993402209 5:87467514-87467536 CCAATCTCAGCCAAGCTGGCCAC No data
Right 993402214 5:87467565-87467587 GCTTCCCATGATTTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993402209 Original CRISPR GTGGCCAGCTTGGCTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr