ID: 993403378

View in Genome Browser
Species Human (GRCh38)
Location 5:87481006-87481028
Sequence AGGTCCAGGGAAAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993403378_993403380 -10 Left 993403378 5:87481006-87481028 CCTTCACACTTTTCCCTGGACCT No data
Right 993403380 5:87481019-87481041 CCCTGGACCTTGTCAACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993403378 Original CRISPR AGGTCCAGGGAAAAGTGTGA AGG (reversed) Intergenic
No off target data available for this crispr