ID: 993406765

View in Genome Browser
Species Human (GRCh38)
Location 5:87520329-87520351
Sequence CCTCTAGCACTGCTGGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993406761_993406765 6 Left 993406761 5:87520300-87520322 CCTCTATATTTCTGTGTGTGTCT 0: 32
1: 344
2: 208
3: 205
4: 1308
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data
993406759_993406765 17 Left 993406759 5:87520289-87520311 CCCACTTCACACCTCTATATTTC 0: 286
1: 267
2: 108
3: 69
4: 231
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data
993406757_993406765 26 Left 993406757 5:87520280-87520302 CCCTGATTTCCCACTTCACACCT 0: 305
1: 240
2: 131
3: 186
4: 530
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data
993406758_993406765 25 Left 993406758 5:87520281-87520303 CCTGATTTCCCACTTCACACCTC 0: 316
1: 242
2: 106
3: 80
4: 401
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data
993406760_993406765 16 Left 993406760 5:87520290-87520312 CCACTTCACACCTCTATATTTCT 0: 274
1: 273
2: 105
3: 64
4: 355
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data
993406756_993406765 27 Left 993406756 5:87520279-87520301 CCCCTGATTTCCCACTTCACACC 0: 290
1: 251
2: 199
3: 116
4: 292
Right 993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993406765 Original CRISPR CCTCTAGCACTGCTGGTTTA GGG Intergenic
No off target data available for this crispr