ID: 993412581

View in Genome Browser
Species Human (GRCh38)
Location 5:87591803-87591825
Sequence GGAAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993412581_993412584 11 Left 993412581 5:87591803-87591825 CCAGTAACAGGCCAAGAGCTTCC No data
Right 993412584 5:87591837-87591859 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
993412581_993412585 15 Left 993412581 5:87591803-87591825 CCAGTAACAGGCCAAGAGCTTCC No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993412581 Original CRISPR GGAAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr