ID: 993412585

View in Genome Browser
Species Human (GRCh38)
Location 5:87591841-87591863
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993412581_993412585 15 Left 993412581 5:87591803-87591825 CCAGTAACAGGCCAAGAGCTTCC No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data
993412579_993412585 22 Left 993412579 5:87591796-87591818 CCAAAACCCAGTAACAGGCCAAG No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data
993412582_993412585 4 Left 993412582 5:87591814-87591836 CCAAGAGCTTCCTCTCAAAAGAA No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data
993412578_993412585 25 Left 993412578 5:87591793-87591815 CCACCAAAACCCAGTAACAGGCC No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data
993412583_993412585 -6 Left 993412583 5:87591824-87591846 CCTCTCAAAAGAAGAGTAGTTAT No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data
993412580_993412585 16 Left 993412580 5:87591802-87591824 CCCAGTAACAGGCCAAGAGCTTC No data
Right 993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993412585 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr