ID: 993413021

View in Genome Browser
Species Human (GRCh38)
Location 5:87595372-87595394
Sequence GCAGCCAGTGAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993413021_993413023 6 Left 993413021 5:87595372-87595394 CCTGCTTTATATTCACTGGCTGC No data
Right 993413023 5:87595401-87595423 GATTGTGTCCACCAGATTAAGGG No data
993413021_993413022 5 Left 993413021 5:87595372-87595394 CCTGCTTTATATTCACTGGCTGC No data
Right 993413022 5:87595400-87595422 AGATTGTGTCCACCAGATTAAGG No data
993413021_993413024 9 Left 993413021 5:87595372-87595394 CCTGCTTTATATTCACTGGCTGC No data
Right 993413024 5:87595404-87595426 TGTGTCCACCAGATTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993413021 Original CRISPR GCAGCCAGTGAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr