ID: 993413022

View in Genome Browser
Species Human (GRCh38)
Location 5:87595400-87595422
Sequence AGATTGTGTCCACCAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993413019_993413022 23 Left 993413019 5:87595354-87595376 CCTTTTCACGTTTTTCTGCCTGC 0: 111
1: 389
2: 318
3: 186
4: 340
Right 993413022 5:87595400-87595422 AGATTGTGTCCACCAGATTAAGG No data
993413021_993413022 5 Left 993413021 5:87595372-87595394 CCTGCTTTATATTCACTGGCTGC No data
Right 993413022 5:87595400-87595422 AGATTGTGTCCACCAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993413022 Original CRISPR AGATTGTGTCCACCAGATTA AGG Intergenic
No off target data available for this crispr